Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 609070
End position: 609099
Length: 30

DNA sequence
>NC_011833, from 609070 to 609099 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTAAATAATTATAAATATTTTGAGATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 608995-610644	Sequence	BUAP5A_566 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 610644 to 608995)