Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 640871
End position: 640900
Length: 30

DNA sequence
>NC_011833, from 640871 to 640900 (30 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) TTTTTTGATATTTTCTTATATTTTTAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 639847-641208	Sequence	BUAP5A_599 engA GTP-binding protein EngA (Protein is coded in complementary strand; from 641208 to 639847)