Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 26156
End position: 26188
Length: 33

DNA sequence
>NC_011833, from 26156 to 26188 (33 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) ATATTTCTTTAATATTTTTTTTATTTTTCTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 25945-27774	Sequence	BUAP5A_026 glmS glucosamine--fructose-6-phosphate aminotransferase (Protein is coded in complementary strand; from 27774 to 25945)