Sequence retrieval

Genome: Buchnera aphidicola str. 5A (Acyrthosiphon pisum)
Start position: 161793
End position: 161828
Length: 36

DNA sequence
>NC_011833, from 161793 to 161828 (36 bp); Buchnera aphidicola str. 5A (Acyrthosiphon pisum) CCACCAAAAATATCACCAAAAACATCCCCAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 160977-162110	Sequence	BUAP5A_150 dnaJ chaperone protein DnaJ (Protein is coded in complementary strand; from 162110 to 160977)