Sequence retrieval

Genome: Streptococcus uberis 0140J
Start position: 1066946
End position: 1066972
Length: 27

DNA sequence
>NC_012004, from 1066946 to 1066972 (27 bp); Streptococcus uberis 0140J TCACGTCCATCACGTCCATCACGTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1066469-1067923	Sequence	SUB1095 sclB collagen-like surface-anchored protein (Protein is coded in complementary strand; from 1067923 to 1066469)