Sequence retrieval

Genome: Streptococcus uberis 0140J
Start position: 1185020
End position: 1185043
Length: 24

DNA sequence
>NC_012004, from 1185020 to 1185043 (24 bp); Streptococcus uberis 0140J ATTTTTAATTTTCTTTTTACTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1185037-1185762	Sequence	SUB1205 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 1185762 to 1185037)