Sequence retrieval

Genome: Streptococcus uberis 0140J
Start position: 1813865
End position: 1813909
Length: 45

DNA sequence
>NC_012004, from 1813865 to 1813909 (45 bp); Streptococcus uberis 0140J ATTTTCTTGACTTATATTATCTTGACTTATATTATCTTGACTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1813434-1814294	Sequence	SUB1830 - hypothetical protein (Protein is coded in complementary strand; from 1814294 to 1813434)