Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 1567790
End position: 1567816
Length: 27

DNA sequence
>NC_012032, from 1567790 to 1567816 (27 bp); Chloroflexus sp. Y-400-fl GTTCAACCAGATCAACCAGTTCATCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1567630-1568532	Sequence	Chy400_1233 - beta-lactamase domain-containing protein (Protein is coded in complementary strand; from 1568532 to 1567630)