Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 2320626
End position: 2320673
Length: 48

DNA sequence
>NC_012032, from 2320626 to 2320673 (48 bp); Chloroflexus sp. Y-400-fl GCCGGTGCAGGGGCTGGTGCCGGGGTCGGTGCCGGGGTCGGTGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2319933-2321252	Sequence	Chy400_1832 - hypothetical protein (Protein is coded in complementary strand; from 2321252 to 2319933)