Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 3109924
End position: 3109977
Length: 54

DNA sequence
>NC_012032, from 3109924 to 3109977 (54 bp); Chloroflexus sp. Y-400-fl GTCGGCGCAGGAGCACTGGTTGGCGCCGGGGCACTGGTCGGTGCCGGGGCACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3107950-3110076	Sequence	Chy400_2463 - sugar ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 3110076 to 3107950)