Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 4006017
End position: 4006040
Length: 24

DNA sequence
>NC_012032, from 4006017 to 4006040 (24 bp); Chloroflexus sp. Y-400-fl CCGGCGCTGGCGCCAGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4005835-4006674	Sequence	Chy400_3210 - hypothetical protein (Protein is coded in complementary strand; from 4006674 to 4005835)