Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 4105605
End position: 4105649
Length: 45

DNA sequence
>NC_012032, from 4105605 to 4105649 (45 bp); Chloroflexus sp. Y-400-fl CACGTTCGGCGGCTTCTCGTTCAGCAGCTTCGCGCTCGGCAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4105052-4106242	Sequence	Chy400_3294 - response regulator receiver protein (Protein is coded in complementary strand; from 4106242 to 4105052)