Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 4189944
End position: 4189970
Length: 27

DNA sequence
>NC_012032, from 4189944 to 4189970 (27 bp); Chloroflexus sp. Y-400-fl GGTGGCGGTGGTGGCGGTGGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4189806-4190828	Sequence	Chy400_3361 - hypothetical protein (Protein is coded in complementary strand; from 4190828 to 4189806)