Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 4588787
End position: 4588810
Length: 24

DNA sequence
>NC_012032, from 4588787 to 4588810 (24 bp); Chloroflexus sp. Y-400-fl GGCCAGGGTCAGGGCCAGGGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4585419-4590323	Sequence	Chy400_3677 - NB-ARC domain-containing protein (Protein is coded in complementary strand; from 4590323 to 4585419)