Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 4640047
End position: 4640070
Length: 24

DNA sequence
>NC_012032, from 4640047 to 4640070 (24 bp); Chloroflexus sp. Y-400-fl GGCCAGCGCCAGCGCCAGGGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4639217-4640428	Sequence	Chy400_3720 - hypothetical protein (Protein is coded in complementary strand; from 4640428 to 4639217)