Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 5080210
End position: 5080236
Length: 27

DNA sequence
>NC_012032, from 5080210 to 5080236 (27 bp); Chloroflexus sp. Y-400-fl TGGCGGCGGTGGCGGCGGTGGCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5079977-5080852	Sequence	Chy400_4102 - hypothetical protein (Protein is coded in complementary strand; from 5080852 to 5079977)