Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 593744
End position: 593788
Length: 45

DNA sequence
>NC_012032, from 593744 to 593788 (45 bp); Chloroflexus sp. Y-400-fl GCGGTTCGACCGGTGGCTGTTCCACCGGTATCGGTTCTGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 593725-595764	Sequence	Chy400_0499 - VanW family protein (Protein is coded in complementary strand; from 595764 to 593725)