Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 769696
End position: 769719
Length: 24

DNA sequence
>NC_012032, from 769696 to 769719 (24 bp); Chloroflexus sp. Y-400-fl GCGCCAGCGCCCGGGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 769359-770207	Sequence	Chy400_0629 - ABC transporter (Protein is coded in complementary strand; from 770207 to 769359)