Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 1234968
End position: 1234991
Length: 24

DNA sequence
>NC_012440, from 1234968 to 1234991 (24 bp); Persephonella marina EX-H1 TATAAAAATATAAAGATATAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1233974-1235143	Sequence	PERMA_1312 - hypothetical protein (Protein is coded in complementary strand; from 1235143 to 1233974)