Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 1236112
End position: 1236135
Length: 24

DNA sequence
>NC_012440, from 1236112 to 1236135 (24 bp); Persephonella marina EX-H1 ATCTAAATCAAAATCTACATTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1236077-1237936	Sequence	PERMA_1314 - TniA transposase (Protein is coded in complementary strand; from 1237936 to 1236077)