Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 1324925
End position: 1324948
Length: 24

DNA sequence
>NC_012440, from 1324925 to 1324948 (24 bp); Persephonella marina EX-H1 ATCTTCATTTTCATCTTAATCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1324013-1324939	Sequence	PERMA_1402 - GTP-binding signal recognition particle SRP54 G- domain protein (Protein is coded in complementary strand; from 1324939 to 1324013)