Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 416989
End position: 417012
Length: 24

DNA sequence
>NC_012440, from 416989 to 417012 (24 bp); Persephonella marina EX-H1 AGAACAGGAACAAAAACAAGAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 415915-418080	Sequence	PERMA_0465 feoB ferrous iron transport protein B (Protein is coded in complementary strand; from 418080 to 415915)