Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 830644
End position: 830667
Length: 24

DNA sequence
>NC_012440, from 830644 to 830667 (24 bp); Persephonella marina EX-H1 TATCAATATCAAGATCAAAATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 829872-831503	Sequence	PERMA_0874 recN DNA repair protein RecN (Protein is coded in complementary strand; from 831503 to 829872)