Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 1627791
End position: 1627817
Length: 27

DNA sequence
>NC_012440, from 1627791 to 1627817 (27 bp); Persephonella marina EX-H1 TAAAAAAGGTAAAAAGGGTAAAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1626986-1627828	Sequence	PERMA_1676 - hypothetical protein
ORF... 1627816-1628199	Sequence	PERMA_1677 - hypothetical protein