Sequence retrieval

Genome: Persephonella marina EX-H1
Start position: 44073
End position: 44102
Length: 30

DNA sequence
>NC_012440, from 44073 to 44102 (30 bp); Persephonella marina EX-H1 GTTTTAAAAGCTGTTAAAAGGTTTTTATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 43105-44103	Sequence	PERMA_0045 - ADP-heptose:LPS heptosyltransferase II
ORF... 44098-44517	Sequence	PERMA_0044 - hypothetical protein (Protein is coded in complementary strand; from 44517 to 44098)