Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 1949115
End position: 1949141
Length: 27

DNA sequence
>NC_012470, from 1949115 to 1949141 (27 bp); Streptococcus equi subsp. zooepidemicus AAAGGTGAAAAAGGCGAAAAAGGAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1948831-1949805	Sequence	SZO_17540 - collagen-like cell surface-anchored protein SclD