Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 1279411
End position: 1279434
Length: 24

DNA sequence
>NC_012470, from 1279411 to 1279434 (24 bp); Streptococcus equi subsp. zooepidemicus GGTTTAGGTTGAGGTTTTGGCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1279234-1280385	Sequence	SZO_11530 - fibrinogen-binding cell surface-anchored protein SzPSe (Protein is coded in complementary strand; from 1280385 to 1279234)