Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 1503592
End position: 1503655
Length: 64

DNA sequence
>NC_012470, from 1503592 to 1503655 (64 bp); Streptococcus equi subsp. zooepidemicus CTTCCATGCTTCCATGCTTCCATGCTTCCATGCTTCCATGCTTCCATGCTTCCATGCTTCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1502062-1503639	Sequence	SZO_13420 - hypothetical protein (Protein is coded in complementary strand; from 1503639 to 1502062)