Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 1674504
End position: 1674557
Length: 54

DNA sequence
>NC_012470, from 1674504 to 1674557 (54 bp); Streptococcus equi subsp. zooepidemicus AACCTGAGCCTAAGCCAGAACCTGAGCCTAAGCCAGAACCTGAGCCTAAGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1672560-1674755	Sequence	SZO_14890 - collagen and fibronectin-binding collagen-like cell surface-anchored protein FneE