Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 2008528
End position: 2008557
Length: 30

DNA sequence
>NC_012470, from 2008528 to 2008557 (30 bp); Streptococcus equi subsp. zooepidemicus TGGTTGATAGTAGTTGATAAGGGTTGACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2008421-2008999	Sequence	SZO_18120 - phosphoglycerate mutase family protein (Protein is coded in complementary strand; from 2008999 to 2008421)