Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 411189
End position: 411212
Length: 24

DNA sequence
>NC_012470, from 411189 to 411212 (24 bp); Streptococcus equi subsp. zooepidemicus CGTCTGCTCATCTGCTTGTCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 409891-411336	Sequence	SZO_03550 - UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase (Protein is coded in complementary strand; from 411336 to 409891)