Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 508231
End position: 508255
Length: 25

DNA sequence
>NC_012470, from 508231 to 508255 (25 bp); Streptococcus equi subsp. zooepidemicus ATAGCAGAGCTTAGCATGGCATTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 507118-509274	Sequence	SZO_04360 - bacteriocin transport/processing ATP-binding protein (Protein is coded in complementary strand; from 509274 to 507118)