Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus
Start position: 621809
End position: 621862
Length: 54

DNA sequence
>NC_012470, from 621809 to 621862 (54 bp); Streptococcus equi subsp. zooepidemicus TTAGGCTGAGGTTCCGGCTTAGGCTGAGGTTCCGGCTTAGGCTGAGGTTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 621386-622972	Sequence	SZO_05350 - collagen-binding surface-anchored protein FneD (Protein is coded in complementary strand; from 622972 to 621386)