Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 1016313
End position: 1016336
Length: 24

DNA sequence
>NC_012526, from 1016313 to 1016336 (24 bp); Deinococcus deserti VCD115 CCCAGCGCCAGCCCCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1015746-1016480	Sequence	Deide_08330 ccmB cytochrome c-type biogenesis protein CcmB (Protein is coded in complementary strand; from 1016480 to 1015746)