Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 1397845
End position: 1397871
Length: 27

DNA sequence
>NC_012526, from 1397845 to 1397871 (27 bp); Deinococcus deserti VCD115 TTCTGTCTTGTCTGTCTTATCTGTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1397871-1399016	Sequence	Deide_11530 - serine--pyruvate transaminase (Protein is coded in complementary strand; from 1399016 to 1397871)