Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 1949516
End position: 1949542
Length: 27

DNA sequence
>NC_012526, from 1949516 to 1949542 (27 bp); Deinococcus deserti VCD115 GCCATGGTCTCCATGGTCTCCATGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1949406-1950188	Sequence	Deide_16060 - hypothetical protein (Protein is coded in complementary strand; from 1950188 to 1949406)