Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 214372
End position: 214395
Length: 24

DNA sequence
>NC_012526, from 214372 to 214395 (24 bp); Deinococcus deserti VCD115 CCAGCGCCAGGGCCAGCACCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 214230-215432	Sequence	Deide_01910 - hypothetical protein (Protein is coded in complementary strand; from 215432 to 214230)