Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 2301538
End position: 2301561
Length: 24

DNA sequence
>NC_012526, from 2301538 to 2301561 (24 bp); Deinococcus deserti VCD115 CACCAGCAGCAGCAGCAGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2300660-2302264	Sequence	Deide_19080 - ABC transporter permease (Protein is coded in complementary strand; from 2302264 to 2300660)