Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 2657511
End position: 2657564
Length: 54

DNA sequence
>NC_012526, from 2657511 to 2657564 (54 bp); Deinococcus deserti VCD115 GTAGGTGCTGGAGCTGGAGTGGGCGCAGGAGCTGGAGTAGGTGCTGGCGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2656410-2658995	Sequence	Deide_22040 - peptidase S8 (Protein is coded in complementary strand; from 2658995 to 2656410)