Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 383050
End position: 383073
Length: 24

DNA sequence
>NC_012526, from 383050 to 383073 (24 bp); Deinococcus deserti VCD115 GGTGGCGATGGCGTTGGCGGTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 382151-383149	Sequence	Deide_03410 - low-affinity inorganic phosphate transporter (Protein is coded in complementary strand; from 383149 to 382151)