Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 448828
End position: 448851
Length: 24

DNA sequence
>NC_012526, from 448828 to 448851 (24 bp); Deinococcus deserti VCD115 CCCATGCCGATGCCCATGCCCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 448060-449061	Sequence	Deide_03900 pdhB pyruvate dehydrogenase E1 component subunit beta (Protein is coded in complementary strand; from 449061 to 448060)