Sequence retrieval

Genome: Deinococcus deserti VCD115
Start position: 880986
End position: 881039
Length: 54

DNA sequence
>NC_012526, from 880986 to 881039 (54 bp); Deinococcus deserti VCD115 GCAGGACCGGCGGGGCCAGCAGGACCGGCAGGGCCAGCAGGACCGGCAGGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 880362-881561	Sequence	Deide_07150 - S-layer protein (Protein is coded in complementary strand; from 881561 to 880362)