Sequence retrieval

Genome: Desulfovibrio magneticus RS-1
Start position: 629068
End position: 629103
Length: 36

DNA sequence
>NC_012796, from 629068 to 629103 (36 bp); Desulfovibrio magneticus RS-1 TTTGGCCTCGGGTTTGGCCTCAGGTTTGGTTTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 628616-629755	Sequence	DMR_05600 - hypothetical protein (Protein is coded in complementary strand; from 629755 to 628616)