Sequence retrieval

Genome: Hirschia baltica ATCC 49814
Start position: 1953720
End position: 1953743
Length: 24

DNA sequence
>NC_012982, from 1953720 to 1953743 (24 bp); Hirschia baltica ATCC 49814 CGGAGGAGGAGGCGGTGGTGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1953334-1954494	Sequence	Hbal_1819 - OmpA/MotB domain-containing protein (Protein is coded in complementary strand; from 1954494 to 1953334)