Sequence retrieval

Genome: Hirschia baltica ATCC 49814
Start position: 2236116
End position: 2236139
Length: 24

DNA sequence
>NC_012982, from 2236116 to 2236139 (24 bp); Hirschia baltica ATCC 49814 CACCAGCAGCAGCAACAGCAACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2235872-2236249	Sequence	Hbal_2091 - 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 2236249 to 2235872)