Sequence retrieval

Genome: Hirschia baltica ATCC 49814
Start position: 3285326
End position: 3285349
Length: 24

DNA sequence
>NC_012982, from 3285326 to 3285349 (24 bp); Hirschia baltica ATCC 49814 AGGAGGAGGAGGAGGCGGAGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3284586-3285461	Sequence	Hbal_2992 - hypothetical protein (Protein is coded in complementary strand; from 3285461 to 3284586)