Sequence retrieval

Genome: Hirschia baltica ATCC 49814
Start position: 777849
End position: 777872
Length: 24

DNA sequence
>NC_012982, from 777849 to 777872 (24 bp); Hirschia baltica ATCC 49814 ATACCAAAACCAATACCGACACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 777300-778691	Sequence	Hbal_0729 - mechanosensitive ion channel MscS (Protein is coded in complementary strand; from 778691 to 777300)