Sequence retrieval

Genome: Hirschia baltica ATCC 49814
Start position: 807569
End position: 807592
Length: 24

DNA sequence
>NC_012982, from 807569 to 807592 (24 bp); Hirschia baltica ATCC 49814 GCTTCTGCTTCGCCTTCTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 807566-808195	Sequence	Hbal_0762 - 50S ribosomal protein L25/general stress protein Ctc (Protein is coded in complementary strand; from 808195 to 807566)