Sequence retrieval

Genome: Lactobacillus plantarum JDM1
Start position: 2396926
End position: 2396970
Length: 45

DNA sequence
>NC_012984, from 2396926 to 2396970 (45 bp); Lactobacillus plantarum JDM1 TTTCAGGGGTTTCAGGGGTTTCAGGGGTTTCAGGGGTTTCAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2396460-2399414	Sequence	JDM1_2245 - cell surface protein precursor (Protein is coded in complementary strand; from 2399414 to 2396460)