Sequence retrieval

Genome: Kangiella koreensis DSM 16069
Start position: 1077037
End position: 1077072
Length: 36

DNA sequence
>NC_013166, from 1077037 to 1077072 (36 bp); Kangiella koreensis DSM 16069 AACTAGAACAAGAACCAAAACAAGAACGAGAACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1075771-1078092	Sequence	Kkor_1024 - DNA polymerase III subunits gamma and tau